Transcript: Human NM_016279.4

Homo sapiens cadherin 9 (CDH9), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CDH9 (1007)
Length:
3082
CDS:
174..2543

Additional Resources:

NCBI RefSeq record:
NM_016279.4
NBCI Gene record:
CDH9 (1007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016279.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416039 ATGATAGTGACCGAGACTAAG pLKO_005 2524 CDS 100% 10.800 15.120 N CDH9 n/a
2 TRCN0000054253 GCACCTACTTATTGCCGATTT pLKO.1 1858 CDS 100% 10.800 15.120 N CDH9 n/a
3 TRCN0000054255 GCATACTGATATGGACCGTAT pLKO.1 1442 CDS 100% 4.050 5.670 N CDH9 n/a
4 TRCN0000054254 GCTGATTGTAACCAAGATTAT pLKO.1 2445 CDS 100% 13.200 9.240 N CDH9 n/a
5 TRCN0000054256 GCTGGCAGTCTATTTGTTATA pLKO.1 462 CDS 100% 13.200 9.240 N CDH9 n/a
6 TRCN0000441508 ACGATGTCCGGGACAACATTG pLKO_005 2122 CDS 100% 10.800 7.560 N CDH9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016279.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05975 pDONR223 100% 99.9% 99.7% None 17A>G;113C>T n/a
2 ccsbBroad304_05975 pLX_304 0% 99.9% 99.7% V5 17A>G;113C>T n/a
Download CSV