Transcript: Human NM_016298.4

Homo sapiens F-box protein 40 (FBXO40), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FBXO40 (51725)
Length:
5669
CDS:
155..2284

Additional Resources:

NCBI RefSeq record:
NM_016298.4
NBCI Gene record:
FBXO40 (51725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016298.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427626 GTGGATGCAAAGGACTATAAC pLKO_005 1058 CDS 100% 13.200 18.480 N FBXO40 n/a
2 TRCN0000128952 GACTCCGAGAAAGAACAGATT pLKO.1 887 CDS 100% 4.950 3.960 N FBXO40 n/a
3 TRCN0000437012 CACCTCCTGCCTGGTAATAAG pLKO_005 244 CDS 100% 13.200 9.240 N FBXO40 n/a
4 TRCN0000128347 CCTTCTGTAAACTGCCTATTT pLKO.1 2370 3UTR 100% 13.200 9.240 N FBXO40 n/a
5 TRCN0000422386 GTGATGAGAGAGCACGAAATT pLKO_005 2608 3UTR 100% 13.200 9.240 N FBXO40 n/a
6 TRCN0000129925 GCCACACAAACATACAACTTT pLKO.1 1433 CDS 100% 5.625 3.938 N FBXO40 n/a
7 TRCN0000128820 GCTGATACACTTTGGTCAGAT pLKO.1 1105 CDS 100% 4.950 3.465 N FBXO40 n/a
8 TRCN0000131170 GTCATGTCTCAATGGCTGGTT pLKO.1 1654 CDS 100% 2.640 1.848 N FBXO40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016298.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03373 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03373 pLX_304 0% 100% 100% V5 n/a
Download CSV