Transcript: Human NM_016383.5

Homo sapiens leucine zipper protein 4 (LUZP4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LUZP4 (51213)
Length:
1746
CDS:
46..987

Additional Resources:

NCBI RefSeq record:
NM_016383.5
NBCI Gene record:
LUZP4 (51213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016383.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115743 CGCCTTCAAGACAGCAATCAA pLKO.1 221 CDS 100% 5.625 7.875 N LUZP4 n/a
2 TRCN0000115742 CCCATTAAGTTGTTCCCGGTA pLKO.1 1181 3UTR 100% 2.160 3.024 N LUZP4 n/a
3 TRCN0000115745 GCCACTCAGAAAGATCTCATA pLKO.1 805 CDS 100% 4.950 3.960 N LUZP4 n/a
4 TRCN0000427128 GTCTCTAGACGACATTATAAT pLKO_005 129 CDS 100% 15.000 10.500 N LUZP4 n/a
5 TRCN0000428043 GTCTGGACAACACCCTTTAAA pLKO_005 345 CDS 100% 15.000 10.500 N LUZP4 n/a
6 TRCN0000427782 TATTGGGACAAAGACATAAAT pLKO_005 1076 3UTR 100% 15.000 10.500 N LUZP4 n/a
7 TRCN0000115746 CCAGCATCAATCAGAAGGAAA pLKO.1 450 CDS 100% 4.950 3.465 N LUZP4 n/a
8 TRCN0000115744 GCCTTTAATTGAGCAGGAGAA pLKO.1 372 CDS 100% 4.050 2.835 N LUZP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016383.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.