Transcript: Human NM_016485.5

Homo sapiens vesicle trafficking 1 (VTA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
VTA1 (51534)
Length:
6991
CDS:
26..949

Additional Resources:

NCBI RefSeq record:
NM_016485.5
NBCI Gene record:
VTA1 (51534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016485.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072689 CCTTCTATACTGCAAGTCTTT pLKO.1 375 CDS 100% 4.950 3.960 N VTA1 n/a
2 TRCN0000380590 AGGCAACATACATCCATAATT pLKO_005 468 CDS 100% 15.000 10.500 N VTA1 n/a
3 TRCN0000381317 ACATGCCATCAGGCAACTATA pLKO_005 633 CDS 100% 13.200 9.240 N VTA1 n/a
4 TRCN0000380473 AGATAGCCAGAATATTCTAAA pLKO_005 1360 3UTR 100% 13.200 9.240 N VTA1 n/a
5 TRCN0000072691 GAAGGCAACATACATCCATAA pLKO.1 466 CDS 100% 10.800 7.560 N VTA1 n/a
6 TRCN0000072688 GCCTGGAAACTTGGTGCTTTA pLKO.1 1695 3UTR 100% 10.800 7.560 N VTA1 n/a
7 TRCN0000072692 GCAAATATGCTGGCAGTGCTT pLKO.1 852 CDS 100% 2.640 1.848 N VTA1 n/a
8 TRCN0000072690 GCACAGGTGTAGCAAGTAATA pLKO.1 717 CDS 100% 13.200 7.920 N VTA1 n/a
9 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4181 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016485.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08310 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_08310 pLX_304 0% 100% 100% V5 n/a
Download CSV