Transcript: Human NM_016526.4

Homo sapiens Bet1 golgi vesicular membrane trafficking protein like (BET1L), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
BET1L (51272)
Length:
2971
CDS:
102..410

Additional Resources:

NCBI RefSeq record:
NM_016526.4
NBCI Gene record:
BET1L (51272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016526.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380640 TGCGGGTGGGTGGTCAAATCA pLKO_005 353 CDS 100% 1.875 2.625 N BET1L n/a
2 TRCN0000043219 GCCCTGGACATCGATAGGGAT pLKO.1 216 CDS 100% 0.880 1.232 N BET1L n/a
3 TRCN0000043221 CGGGAGAACAAGCGAATGGCT pLKO.1 156 CDS 100% 0.250 0.200 N BET1L n/a
4 TRCN0000043222 CGGTACCTGGATGGCATGGTA pLKO.1 252 CDS 100% 0.000 0.000 N BET1L n/a
5 TRCN0000380456 AGACAACCGGAAGCTTCTATG pLKO_005 488 3UTR 100% 10.800 7.560 N BET1L n/a
6 TRCN0000381400 CACCACTTCTGTGTGATCTTG pLKO_005 372 CDS 100% 4.950 3.465 N BET1L n/a
7 TRCN0000381298 GTGACCTGATGAGCTCATGTT pLKO_005 736 3UTR 100% 4.950 3.465 N BET1L n/a
8 TRCN0000379679 GGCATGGCCGTGGGTCTAATT pLKO_005 510 3UTR 100% 4.400 3.080 N BET1L n/a
9 TRCN0000381390 GAACAAGCGAATGGCTGACAG pLKO_005 161 CDS 100% 4.050 2.835 N BET1L n/a
10 TRCN0000380118 TGACAGCCTGGCCTCCAAAGT pLKO_005 176 CDS 100% 1.650 1.155 N BET1L n/a
11 TRCN0000043218 TGGGTGGTCAAATCACCACTT pLKO.1 359 CDS 100% 0.405 0.284 N BET1L n/a
12 TRCN0000043220 CTGTGTGATCTTGCTGGGATT pLKO.1 380 CDS 100% 4.050 2.430 N BET1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016526.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.