Transcript: Human NM_016545.5

Homo sapiens immediate early response 5 (IER5), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
IER5 (51278)
Length:
4201
CDS:
204..1187

Additional Resources:

NCBI RefSeq record:
NM_016545.5
NBCI Gene record:
IER5 (51278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016545.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248615 TTCTCGGGACTCCTACGGAAA pLKO_005 1032 CDS 100% 4.050 3.240 N Ier5 n/a
2 TRCN0000161506 GACTCCAGTCTTTGTTGTATA pLKO.1 2005 3UTR 100% 13.200 9.240 N IER5 n/a
3 TRCN0000158807 GCTTGGAAATAATGGAGTTTA pLKO.1 1857 3UTR 100% 13.200 9.240 N IER5 n/a
4 TRCN0000166198 CTCTGGGCAAGATCTACAACT pLKO.1 244 CDS 100% 4.950 3.465 N IER5 n/a
5 TRCN0000166390 CCAAGAGCACAGACTTGGATT pLKO.1 1697 3UTR 100% 0.495 0.347 N IER5 n/a
6 TRCN0000164771 CATCTCTCTGGGCAAGATCTA pLKO.1 239 CDS 100% 4.950 2.970 N IER5 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3858 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3858 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016545.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.