Transcript: Human NM_016578.3

Homo sapiens remodeling and spacing factor 1 (RSF1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
RSF1 (51773)
Length:
5138
CDS:
121..4446

Additional Resources:

NCBI RefSeq record:
NM_016578.3
NBCI Gene record:
RSF1 (51773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379638 ACAAATGTGGGTCGTACTTTA pLKO_005 2425 CDS 100% 13.200 18.480 N RSF1 n/a
2 TRCN0000380714 GCCGAAGCACAGACGAGTATT pLKO_005 3944 CDS 100% 13.200 18.480 N RSF1 n/a
3 TRCN0000128361 GAGTTTGTTGTGTCTGATGAA pLKO.1 3472 CDS 100% 4.950 3.960 N RSF1 n/a
4 TRCN0000280788 GAGTTTGTTGTGTCTGATGAA pLKO_005 3472 CDS 100% 4.950 3.960 N RSF1 n/a
5 TRCN0000128484 GTGCTAATTTATTCCACGGTA pLKO.1 4465 3UTR 100% 2.640 2.112 N RSF1 n/a
6 TRCN0000280787 GTGCTAATTTATTCCACGGTA pLKO_005 4465 3UTR 100% 2.640 2.112 N RSF1 n/a
7 TRCN0000218422 GTTCATGGTCCTTGGTAATTT pLKO_005 4665 3UTR 100% 15.000 10.500 N Rsf1 n/a
8 TRCN0000128604 CCAGTTCTGAACTTTGAAGAT pLKO.1 4604 3UTR 100% 4.950 3.465 N RSF1 n/a
9 TRCN0000280712 CCAGTTCTGAACTTTGAAGAT pLKO_005 4604 3UTR 100% 4.950 3.465 N RSF1 n/a
10 TRCN0000182990 CCTTGTTGATTATGTCTGTAA pLKO.1 4410 CDS 100% 4.950 3.465 N RSF1 n/a
11 TRCN0000148481 CTTCTGAGACAAAGGGTTCTA pLKO.1 2201 CDS 100% 4.950 3.465 N RSF1 n/a
12 TRCN0000280789 CTTCTGAGACAAAGGGTTCTA pLKO_005 2201 CDS 100% 4.950 3.465 N RSF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.