Transcript: Human NM_016604.4

Homo sapiens lysine demethylase 3B (KDM3B), mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
KDM3B (51780)
Length:
6724
CDS:
112..5397

Additional Resources:

NCBI RefSeq record:
NM_016604.4
NBCI Gene record:
KDM3B (51780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016604.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274438 ACAACGCCTATGGGTTGATAA pLKO_005 4733 CDS 100% 13.200 18.480 N KDM3B n/a
2 TRCN0000381005 TGCACGTGACCTCTGACAAAG pLKO_005 5845 3UTR 100% 10.800 15.120 N KDM3B n/a
3 TRCN0000017095 GCGATCTTTGTAGAATTTGAT pLKO.1 301 CDS 100% 5.625 7.875 N KDM3B n/a
4 TRCN0000274439 GCGATCTTTGTAGAATTTGAT pLKO_005 301 CDS 100% 5.625 7.875 N KDM3B n/a
5 TRCN0000017097 CCTTGTAGATAAACTGGGTTT pLKO.1 483 CDS 100% 4.050 5.670 N KDM3B n/a
6 TRCN0000274437 GGACTCCATCACTCGTCTTAT pLKO_005 777 CDS 100% 13.200 9.240 N KDM3B n/a
7 TRCN0000274436 CACATAACTGGTACAAGTATG pLKO_005 5780 3UTR 100% 10.800 7.560 N KDM3B n/a
8 TRCN0000380564 CCTCTGTGAAGCAGGTCTTTC pLKO_005 5418 3UTR 100% 10.800 7.560 N KDM3B n/a
9 TRCN0000017093 CCCTAGTTCATCGCAACCTTT pLKO.1 1539 CDS 100% 4.950 3.465 N KDM3B n/a
10 TRCN0000274391 CCCTAGTTCATCGCAACCTTT pLKO_005 1539 CDS 100% 4.950 3.465 N KDM3B n/a
11 TRCN0000017096 GCTGTTAATGTGATGGTGTAT pLKO.1 4807 CDS 100% 4.950 3.465 N KDM3B n/a
12 TRCN0000017094 CCGATGTGAAAGTTCGGGATT pLKO.1 4475 CDS 100% 4.050 2.835 N KDM3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016604.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.