Transcript: Mouse NM_016658.3

Mus musculus galactose-1-phosphate uridyl transferase (Galt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Galt (14430)
Length:
2132
CDS:
401..1483

Additional Resources:

NCBI RefSeq record:
NM_016658.3
NBCI Gene record:
Galt (14430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016658.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328401 CCAAGTACGACAATCTATTTG pLKO_005 1194 CDS 100% 13.200 18.480 N Galt n/a
2 TRCN0000328402 CGCTTCCCGAGGTACACTATT pLKO_005 1422 CDS 100% 13.200 18.480 N Galt n/a
3 TRCN0000374922 ATCCGCAACTGTCCGGAAGTT pLKO_005 1327 CDS 100% 4.950 6.930 N Galt n/a
4 TRCN0000111394 CTCTTGACCAAGTACGACAAT pLKO.1 1187 CDS 100% 4.950 6.930 N Galt n/a
5 TRCN0000374983 ACTCTTACATTCCGGAGTTTG pLKO_005 1615 3UTR 100% 10.800 8.640 N Galt n/a
6 TRCN0000328403 ACAGGCCGCAGAAAGATTAAG pLKO_005 1399 CDS 100% 13.200 9.240 N Galt n/a
7 TRCN0000328465 ACCCTTGGGTGCAGATCTTTG pLKO_005 837 CDS 100% 10.800 7.560 N Galt n/a
8 TRCN0000111392 CAGAGGAGTTTGTAAGGTCAT pLKO.1 709 CDS 100% 4.050 2.835 N Galt n/a
9 TRCN0000111393 CCTTTGTTATTGGAATATGGT pLKO.1 989 CDS 100% 3.000 2.100 N Galt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016658.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06253 pDONR223 100% 82.5% 87% None (many diffs) n/a
2 ccsbBroad304_06253 pLX_304 0% 82.5% 87% V5 (many diffs) n/a
Download CSV