Transcript: Mouse NM_016667.3

Mus musculus syntrophin, basic 1 (Sntb1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sntb1 (20649)
Length:
2153
CDS:
359..1972

Additional Resources:

NCBI RefSeq record:
NM_016667.3
NBCI Gene record:
Sntb1 (20649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113009 CCTGGTTGTTCTGACTGAGAA pLKO.1 1387 CDS 100% 4.950 6.930 N Sntb1 n/a
2 TRCN0000113007 GCACCAAGCAAGGAATTGAAA pLKO.1 1563 CDS 100% 5.625 3.938 N Sntb1 n/a
3 TRCN0000113006 GCCACACCTTACGTGAAGAAA pLKO.1 944 CDS 100% 5.625 3.938 N Sntb1 n/a
4 TRCN0000113008 CTGGTTGTTCTGACTGAGAAA pLKO.1 1388 CDS 100% 4.950 3.465 N Sntb1 n/a
5 TRCN0000113005 CGACTTGCCTTTGGAAAGGAA pLKO.1 1982 3UTR 100% 3.000 2.100 N Sntb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.