Transcript: Mouse NM_016677.4

Mus musculus hippocalcin-like 1 (Hpcal1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Hpcal1 (53602)
Length:
1561
CDS:
258..839

Additional Resources:

NCBI RefSeq record:
NM_016677.4
NBCI Gene record:
Hpcal1 (53602)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016677.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104744 GACTGTGGACGAGTTCAAGAA pLKO.1 386 CDS 100% 4.950 3.465 N Hpcal1 n/a
2 TRCN0000327206 GACTGTGGACGAGTTCAAGAA pLKO_005 386 CDS 100% 4.950 3.465 N Hpcal1 n/a
3 TRCN0000306646 TTTAGCATGTACGACCTGGAC pLKO_005 570 CDS 100% 2.160 1.512 N Hpcal1 n/a
4 TRCN0000104742 CCTGCGGGAACACACGGAATT pLKO.1 302 CDS 100% 0.000 0.000 N Hpcal1 n/a
5 TRCN0000306648 TACGGTGAGATGGACTATAAT pLKO_005 1299 3UTR 100% 15.000 9.000 N Hpcal1 n/a
6 TRCN0000104740 CCTTCCAATGGTTCAAGTGTT pLKO.1 1021 3UTR 100% 4.950 2.970 N Hpcal1 n/a
7 TRCN0000327292 CCTTCCAATGGTTCAAGTGTT pLKO_005 1021 3UTR 100% 4.950 2.970 N Hpcal1 n/a
8 TRCN0000104741 CGCAGTGAAATGCTGGAGATA pLKO.1 609 CDS 100% 4.950 2.970 N Hpcal1 n/a
9 TRCN0000104743 GACACAAACAATGATGGCAAA pLKO.1 726 CDS 100% 4.050 2.430 N Hpcal1 n/a
10 TRCN0000306583 TATCTTACCAAGACCAGCTAA pLKO_005 1114 3UTR 100% 4.950 2.475 Y Hpcal1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016677.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.