Transcript: Mouse NM_016717.3

Mus musculus selenocysteine lyase (Scly), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Scly (50880)
Length:
2207
CDS:
59..1357

Additional Resources:

NCBI RefSeq record:
NM_016717.3
NBCI Gene record:
Scly (50880)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016717.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099411 CGAGATCAGTCGGCGAATTAA pLKO.1 643 CDS 100% 15.000 21.000 N Scly n/a
2 TRCN0000327373 CGAGATCAGTCGGCGAATTAA pLKO_005 643 CDS 100% 15.000 21.000 N Scly n/a
3 TRCN0000099412 AGGAAGGTCTATATGGACTAT pLKO.1 110 CDS 100% 4.950 6.930 N Scly n/a
4 TRCN0000327375 AGGAAGGTCTATATGGACTAT pLKO_005 110 CDS 100% 4.950 6.930 N Scly n/a
5 TRCN0000099414 CTCCTATGTGTCAGGTAGGAA pLKO.1 211 CDS 100% 0.300 0.420 N Scly n/a
6 TRCN0000327376 CTCCTATGTGTCAGGTAGGAA pLKO_005 211 CDS 100% 0.300 0.420 N Scly n/a
7 TRCN0000099413 GAGTTTGGTAAGAGAATCCAT pLKO.1 1031 CDS 100% 3.000 2.400 N Scly n/a
8 TRCN0000363617 GAGTTTGGTAAGAGAATCCAT pLKO_005 1031 CDS 100% 3.000 2.400 N Scly n/a
9 TRCN0000099410 CCATAGGAAACCGCTTGCAAA pLKO.1 1404 3UTR 100% 4.950 3.465 N Scly n/a
10 TRCN0000327452 CCATAGGAAACCGCTTGCAAA pLKO_005 1404 3UTR 100% 4.950 3.465 N Scly n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016717.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.