Transcript: Mouse NM_016737.2

Mus musculus stress-induced phosphoprotein 1 (Stip1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Stip1 (20867)
Length:
2173
CDS:
139..1770

Additional Resources:

NCBI RefSeq record:
NM_016737.2
NBCI Gene record:
Stip1 (20867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115460 CCATTCAACTTGCCTAATCTA pLKO.1 517 CDS 100% 5.625 3.938 N Stip1 n/a
2 TRCN0000325641 CCATTCAACTTGCCTAATCTA pLKO_005 517 CDS 100% 5.625 3.938 N Stip1 n/a
3 TRCN0000115459 GCACAGTACAACAGACATGAT pLKO.1 1558 CDS 100% 4.950 3.465 N Stip1 n/a
4 TRCN0000325639 GCACAGTACAACAGACATGAT pLKO_005 1558 CDS 100% 4.950 3.465 N Stip1 n/a
5 TRCN0000148341 CGAACACTTAAAGAATCCTGT pLKO.1 1695 CDS 100% 2.640 1.848 N STIP1 n/a
6 TRCN0000115458 CGAACCTATGAAGAAGGTTTA pLKO.1 415 CDS 100% 1.080 0.756 N Stip1 n/a
7 TRCN0000325642 CGAACCTATGAAGAAGGTTTA pLKO_005 415 CDS 100% 1.080 0.756 N Stip1 n/a
8 TRCN0000115456 GAGAAGAAAGGCTTATCTTTA pLKO.1 1852 3UTR 100% 13.200 7.920 N Stip1 n/a
9 TRCN0000325567 GAGAAGAAAGGCTTATCTTTA pLKO_005 1852 3UTR 100% 13.200 7.920 N Stip1 n/a
10 TRCN0000115457 GCCAACCTTCATCAAGGGTTA pLKO.1 1410 CDS 100% 4.050 2.430 N Stip1 n/a
11 TRCN0000325640 GCCAACCTTCATCAAGGGTTA pLKO_005 1410 CDS 100% 4.050 2.430 N Stip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02577 pDONR223 100% 88.2% 97.4% None (many diffs) n/a
2 ccsbBroad304_02577 pLX_304 0% 88.2% 97.4% V5 (many diffs) n/a
Download CSV