Transcript: Mouse NM_016770.3

Mus musculus folate hydrolase 1 (Folh1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Folh1 (53320)
Length:
3047
CDS:
106..2364

Additional Resources:

NCBI RefSeq record:
NM_016770.3
NBCI Gene record:
Folh1 (53320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032194 CGTGCATTCATTGATCCTTTA pLKO.1 2128 CDS 100% 10.800 15.120 N Folh1 n/a
2 TRCN0000006807 GCACGAACTGAAGACTTCTTT pLKO.1 649 CDS 100% 5.625 4.500 N FOLH1 n/a
3 TRCN0000032197 GCCTGGATTTGGTTGAGTTAT pLKO.1 422 CDS 100% 13.200 9.240 N Folh1 n/a
4 TRCN0000032195 CCAGACAGATATGTTATTCTT pLKO.1 1213 CDS 100% 5.625 3.938 N Folh1 n/a
5 TRCN0000032196 GCATGAATTGAAGGCTGAGAA pLKO.1 297 CDS 100% 4.950 2.970 N Folh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.