Transcript: Mouse NM_016803.3

Mus musculus carbohydrate (chondroitin 6/keratan) sulfotransferase 3 (Chst3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Chst3 (53374)
Length:
6129
CDS:
599..2035

Additional Resources:

NCBI RefSeq record:
NM_016803.3
NBCI Gene record:
Chst3 (53374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016803.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103204 GAGGTTGGATCTACGAGTCAT pLKO.1 1468 CDS 100% 4.950 6.930 N Chst3 n/a
2 TRCN0000103201 GCCTAAAGATTCGAGGCAGAT pLKO.1 666 CDS 100% 4.050 5.670 N Chst3 n/a
3 TRCN0000103202 CCCTTCGTCAAGAAGGTCTTT pLKO.1 1304 CDS 100% 0.495 0.693 N Chst3 n/a
4 TRCN0000103200 CCCAGCATTCAGGAAATCAAA pLKO.1 3389 3UTR 100% 5.625 3.938 N Chst3 n/a
5 TRCN0000103203 GATGTCTACTCCACTCAGAAA pLKO.1 1832 CDS 100% 4.950 3.465 N Chst3 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2960 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 5956 3UTR 100% 2.640 1.320 Y Adsl n/a
8 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 5956 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016803.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.