Transcript: Mouse NM_016867.1

Mus musculus GIPC PDZ domain containing family, member 2 (Gipc2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gipc2 (54120)
Length:
1286
CDS:
14..958

Additional Resources:

NCBI RefSeq record:
NM_016867.1
NBCI Gene record:
Gipc2 (54120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097812 GCAATCGGAAAGGTTGATGAT pLKO.1 749 CDS 100% 4.950 6.930 N Gipc2 n/a
2 TRCN0000332478 GCAATCGGAAAGGTTGATGAT pLKO_005 749 CDS 100% 4.950 6.930 N Gipc2 n/a
3 TRCN0000097813 TGTACCTTAAATACGCCTAAA pLKO.1 263 CDS 100% 10.800 7.560 N Gipc2 n/a
4 TRCN0000332477 TGTACCTTAAATACGCCTAAA pLKO_005 263 CDS 100% 10.800 7.560 N Gipc2 n/a
5 TRCN0000097810 CACTGTTATGAACTCTACTTT pLKO.1 1025 3UTR 100% 5.625 3.938 N Gipc2 n/a
6 TRCN0000332549 CACTGTTATGAACTCTACTTT pLKO_005 1025 3UTR 100% 5.625 3.938 N Gipc2 n/a
7 TRCN0000097814 GAGCTCTTTACTTTGCAGTTA pLKO.1 578 CDS 100% 4.950 3.465 N Gipc2 n/a
8 TRCN0000332479 GAGCTCTTTACTTTGCAGTTA pLKO_005 578 CDS 100% 4.950 3.465 N Gipc2 n/a
9 TRCN0000097811 GCGTCACTTTGAAGTCGCTAA pLKO.1 532 CDS 100% 4.050 2.835 N Gipc2 n/a
10 TRCN0000332560 GCGTCACTTTGAAGTCGCTAA pLKO_005 532 CDS 100% 4.050 2.835 N Gipc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.