Transcript: Mouse NM_016889.3

Mus musculus insulinoma-associated 1 (Insm1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Insm1 (53626)
Length:
3038
CDS:
270..1835

Additional Resources:

NCBI RefSeq record:
NM_016889.3
NBCI Gene record:
Insm1 (53626)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014613 CCACACGATTAGCTTTATTAT pLKO.1 2310 3UTR 100% 15.000 21.000 N INSM1 n/a
2 TRCN0000085038 CCCACACGATTAGCTTTATTA pLKO.1 2309 3UTR 100% 15.000 21.000 N Insm1 n/a
3 TRCN0000419738 CACGAGAAGCACAAGTACTTC pLKO_005 603 CDS 100% 4.950 6.930 N Insm1 n/a
4 TRCN0000014615 GCACGAGAAGCACAAGTACTT pLKO.1 602 CDS 100% 4.950 6.930 N INSM1 n/a
5 TRCN0000085042 GCAGCACAAGTGCTCGCGCAT pLKO.1 1133 CDS 100% 0.000 0.000 N Insm1 n/a
6 TRCN0000085039 CGTCTGAGAATAGACAGGTGA pLKO.1 1780 CDS 100% 2.640 2.112 N Insm1 n/a
7 TRCN0000413103 ACTCCCATTCCAGGGTGAAAG pLKO_005 1930 3UTR 100% 10.800 7.560 N Insm1 n/a
8 TRCN0000433336 CAACAGGAGTCCGTCTCTTTC pLKO_005 2060 3UTR 100% 10.800 7.560 N Insm1 n/a
9 TRCN0000085040 GCTCAAGATGGGCACTGCGTT pLKO.1 776 CDS 100% 0.880 0.616 N Insm1 n/a
10 TRCN0000420120 TGCACTTCGAGGACGAGGTGA pLKO_005 970 CDS 100% 0.880 0.616 N Insm1 n/a
11 TRCN0000085041 CGCCGAGGACATCCTGGCTTT pLKO.1 1511 CDS 100% 0.000 0.000 N Insm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016889.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.