Transcript: Mouse NM_016914.2

Mus musculus proteoglycan 3 (Prg3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Prg3 (53856)
Length:
949
CDS:
161..829

Additional Resources:

NCBI RefSeq record:
NM_016914.2
NBCI Gene record:
Prg3 (53856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099721 CCTTAAATAAGGACTCTGCTT pLKO.1 408 CDS 100% 2.640 3.696 N Prg3 n/a
2 TRCN0000441101 TCAATCAGTCCATCGTCTGGA pLKO_005 618 CDS 100% 2.640 3.696 N Prg3 n/a
3 TRCN0000099722 CCCGAGACATTTGATAAGGCT pLKO.1 506 CDS 100% 0.750 1.050 N Prg3 n/a
4 TRCN0000099720 CCACAGTTATAGTTTCAACTA pLKO.1 571 CDS 100% 4.950 3.465 N Prg3 n/a
5 TRCN0000435332 GGGTTCCCAACACCAAGACAT pLKO_005 349 CDS 100% 4.950 3.465 N Prg3 n/a
6 TRCN0000444727 TGGCGAAGAGCTTCATGCAAA pLKO_005 779 CDS 100% 4.950 3.465 N Prg3 n/a
7 TRCN0000099723 GCAATGGAGTCAGATCCAGAT pLKO.1 386 CDS 100% 4.050 2.835 N Prg3 n/a
8 TRCN0000099724 GAGAATCCCAAGAGAGAGGAA pLKO.1 236 CDS 100% 2.640 1.848 N Prg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.