Transcript: Mouse NM_017366.3

Mus musculus acyl-Coenzyme A dehydrogenase, very long chain (Acadvl), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Acadvl (11370)
Length:
2205
CDS:
105..2075

Additional Resources:

NCBI RefSeq record:
NM_017366.3
NBCI Gene record:
Acadvl (11370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041332 CTTTGCCAAGACGCCAATTAA pLKO.1 890 CDS 100% 15.000 21.000 N Acadvl n/a
2 TRCN0000315483 CTTTGCCAAGACGCCAATTAA pLKO_005 890 CDS 100% 15.000 21.000 N Acadvl n/a
3 TRCN0000041328 GCGGTTGATCATGCTACTAAT pLKO.1 1182 CDS 100% 13.200 18.480 N Acadvl n/a
4 TRCN0000303264 GCGGTTGATCATGCTACTAAT pLKO_005 1182 CDS 100% 13.200 18.480 N Acadvl n/a
5 TRCN0000041329 CGGATGGCTATTCTGCAGTAT pLKO.1 1260 CDS 100% 4.950 3.960 N Acadvl n/a
6 TRCN0000303261 CGGATGGCTATTCTGCAGTAT pLKO_005 1260 CDS 100% 4.950 3.960 N Acadvl n/a
7 TRCN0000041331 CGGTTCTTTGAGGAAGTGAAT pLKO.1 438 CDS 100% 4.950 3.465 N Acadvl n/a
8 TRCN0000303192 CGGTTCTTTGAGGAAGTGAAT pLKO_005 438 CDS 100% 4.950 3.465 N Acadvl n/a
9 TRCN0000041330 GCGATCTACTACTGTGCTTCA pLKO.1 170 CDS 100% 4.050 2.835 N Acadvl n/a
10 TRCN0000303191 GCGATCTACTACTGTGCTTCA pLKO_005 170 CDS 100% 4.050 2.835 N Acadvl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017366.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.