Transcript: Human NM_017580.3

Homo sapiens zinc finger RANBP2-type containing 1 (ZRANB1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ZRANB1 (54764)
Length:
5695
CDS:
372..2498

Additional Resources:

NCBI RefSeq record:
NM_017580.3
NBCI Gene record:
ZRANB1 (54764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246109 TATTCTTAGACGACCAATTAT pLKO_005 1964 CDS 100% 15.000 12.000 N ZRANB1 n/a
2 TRCN0000348585 TATTCTTAGACGACCAATTAT pLKO_005 1964 CDS 100% 15.000 12.000 N Zranb1 n/a
3 TRCN0000246111 CAAGGGTGAAATCTTCGTATA pLKO_005 592 CDS 100% 10.800 8.640 N ZRANB1 n/a
4 TRCN0000222564 CACGCTGGAAAGATTGGGAAT pLKO.1 1807 CDS 100% 4.050 3.240 N ZRANB1 n/a
5 TRCN0000246108 ACTTAGCATCTGTAGTAATTT pLKO_005 4226 3UTR 100% 15.000 10.500 N ZRANB1 n/a
6 TRCN0000246107 TGATCATCCCAGACCTAATAA pLKO_005 887 CDS 100% 15.000 10.500 N ZRANB1 n/a
7 TRCN0000246110 AGGAACTTGAAGTAGACTTTA pLKO_005 1099 CDS 100% 13.200 9.240 N ZRANB1 n/a
8 TRCN0000073813 CCAAGGCATCAGATCTGTAAT pLKO.1 2523 3UTR 100% 13.200 9.240 N ZRANB1 n/a
9 TRCN0000073815 GCTGGAAAGATTGGGAATCAT pLKO.1 1810 CDS 100% 5.625 3.938 N ZRANB1 n/a
10 TRCN0000073817 CCATAGAAGCATACAAGTCAT pLKO.1 1210 CDS 100% 4.950 3.465 N ZRANB1 n/a
11 TRCN0000030972 GCCTGCATGACTGTTCACATT pLKO.1 1777 CDS 100% 4.950 3.465 N Zranb1 n/a
12 TRCN0000335312 GCCTGCATGACTGTTCACATT pLKO_005 1777 CDS 100% 4.950 3.465 N Zranb1 n/a
13 TRCN0000073814 GCAGTAGTGGTAATAGCCAAA pLKO.1 991 CDS 100% 4.050 2.835 N ZRANB1 n/a
14 TRCN0000030969 CCCAGACCTAATAACATTGAA pLKO.1 894 CDS 100% 5.625 3.375 N Zranb1 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3798 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.