Transcript: Human NM_017592.4

Homo sapiens mediator complex subunit 29 (MED29), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
MED29 (55588)
Length:
3590
CDS:
46..648

Additional Resources:

NCBI RefSeq record:
NM_017592.4
NBCI Gene record:
MED29 (55588)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017592.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422801 CCTAGCCTAGGGTAGACTTTG pLKO_005 848 3UTR 100% 10.800 15.120 N MED29 n/a
2 TRCN0000005459 GCAGCGTTATAAGATGCTCAT pLKO.1 216 CDS 100% 4.050 5.670 N MED29 n/a
3 TRCN0000010940 ACAGAGTTGTGACAGTGCCAA pLKO.1 429 CDS 100% 2.640 3.696 N MED29 n/a
4 TRCN0000005458 CGGTCATCAAAGCCCAGATTT pLKO.1 530 CDS 100% 13.200 9.240 N MED29 n/a
5 TRCN0000005460 CAGAACACTAACATCGACAAT pLKO.1 295 CDS 100% 4.950 3.465 N MED29 n/a
6 TRCN0000424751 GAGAGTCTACAGACCTTGATG pLKO_005 250 CDS 100% 4.950 3.465 N MED29 n/a
7 TRCN0000005457 GCCTGTATTTGTGGAGCTGAT pLKO.1 2936 3UTR 100% 4.050 2.835 N MED29 n/a
8 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 2221 3UTR 100% 4.950 2.475 Y GJD4 n/a
9 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 2221 3UTR 100% 4.950 2.475 Y C9orf85 n/a
10 TRCN0000278777 TGATTCAGAACACTAACATTG pLKO_005 290 CDS 100% 10.800 8.640 N Med29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017592.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12227 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12227 pLX_304 0% 100% 100% V5 n/a
Download CSV