Transcript: Human NM_017784.4

Homo sapiens oxysterol binding protein like 10 (OSBPL10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
OSBPL10 (114884)
Length:
4231
CDS:
672..2966

Additional Resources:

NCBI RefSeq record:
NM_017784.4
NBCI Gene record:
OSBPL10 (114884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017784.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147511 GTCATTTGCTTCGTTGAGTAT pLKO.1 2034 CDS 100% 4.950 6.930 N OSBPL10 n/a
2 TRCN0000330359 GTCATTTGCTTCGTTGAGTAT pLKO_005 2034 CDS 100% 4.950 6.930 N OSBPL10 n/a
3 TRCN0000330427 CCCATCATAGGCGAGACATTT pLKO_005 2112 CDS 100% 13.200 10.560 N OSBPL10 n/a
4 TRCN0000146458 CCAACATAACCTGGGCAATTT pLKO.1 1699 CDS 100% 13.200 9.240 N OSBPL10 n/a
5 TRCN0000105028 GAAGAGCCAAGAGTCAGTATT pLKO.1 1354 CDS 100% 13.200 9.240 N Osbpl10 n/a
6 TRCN0000353606 GATAAGGAAGAGACGGAATTG pLKO_005 1821 CDS 100% 10.800 7.560 N OSBPL10 n/a
7 TRCN0000149085 GCCTTTACACATGAGGTCAAA pLKO.1 3978 3UTR 100% 4.950 3.465 N OSBPL10 n/a
8 TRCN0000149806 GACAGTGATATTCCACACGAA pLKO.1 2537 CDS 100% 2.640 1.848 N OSBPL10 n/a
9 TRCN0000330360 GACAGTGATATTCCACACGAA pLKO_005 2537 CDS 100% 2.640 1.848 N OSBPL10 n/a
10 TRCN0000147037 CCCAAGAAAGATAAGCAAGTA pLKO.1 3520 3UTR 100% 4.950 2.970 N OSBPL10 n/a
11 TRCN0000330426 CCCAAGAAAGATAAGCAAGTA pLKO_005 3520 3UTR 100% 4.950 2.970 N OSBPL10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017784.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.