Transcript: Human NM_017947.4

Homo sapiens molybdenum cofactor sulfurase (MOCOS), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MOCOS (55034)
Length:
6182
CDS:
44..2710

Additional Resources:

NCBI RefSeq record:
NM_017947.4
NBCI Gene record:
MOCOS (55034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017947.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274997 GAACGTGACCATGGCTATAAA pLKO_005 520 CDS 100% 15.000 21.000 N MOCOS n/a
2 TRCN0000274922 TGATCAACACATCCAGTATTT pLKO_005 2265 CDS 100% 13.200 9.240 N MOCOS n/a
3 TRCN0000168071 CCTTGATGTTATCGCGCTAAA pLKO.1 1009 CDS 100% 10.800 7.560 N MOCOS n/a
4 TRCN0000135668 GAACAACTCGTCTACTGTGAA pLKO.1 1669 CDS 100% 4.950 3.465 N MOCOS n/a
5 TRCN0000281959 GAACAACTCGTCTACTGTGAA pLKO_005 1669 CDS 100% 4.950 3.465 N MOCOS n/a
6 TRCN0000137914 GAAGGATCTCAGCTTGCGTTT pLKO.1 2347 CDS 100% 4.050 2.835 N MOCOS n/a
7 TRCN0000135967 GAGTCGTGAAACAAAGGTGAA pLKO.1 2542 CDS 100% 4.050 2.835 N MOCOS n/a
8 TRCN0000274998 GAGTCGTGAAACAAAGGTGAA pLKO_005 2542 CDS 100% 4.050 2.835 N MOCOS n/a
9 TRCN0000167049 CCATCTCATTCCTTGATGTTA pLKO.1 999 CDS 100% 5.625 3.375 N MOCOS n/a
10 TRCN0000134162 CAAAGGGAACATCATTGGTTA pLKO.1 1234 CDS 100% 4.950 2.970 N MOCOS n/a
11 TRCN0000274925 CAAAGGGAACATCATTGGTTA pLKO_005 1234 CDS 100% 4.950 2.970 N MOCOS n/a
12 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 4477 3UTR 100% 4.950 2.475 Y CENPL n/a
13 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 5106 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
14 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 5106 3UTR 100% 1.080 0.540 Y TNNI1 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4964 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017947.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08460 pDONR223 100% 99.7% 99.4% None (many diffs) n/a
2 ccsbBroad304_08460 pLX_304 0% 99.7% 99.4% V5 (many diffs) n/a
Download CSV