Transcript: Human NM_018151.5

Homo sapiens replication timing regulatory factor 1 (RIF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
RIF1 (55183)
Length:
14662
CDS:
143..7561

Additional Resources:

NCBI RefSeq record:
NM_018151.5
NBCI Gene record:
RIF1 (55183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018151.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071342 CCAGCATATCAGGTTGCTAAT pLKO.1 1841 CDS 100% 10.800 15.120 N Rif1 n/a
2 TRCN0000154312 CCAGCATATCAGGTTGCTAAT pLKO.1 1841 CDS 100% 10.800 15.120 N RIF1 n/a
3 TRCN0000158124 CCGTGTTTAGGAGACTCGAAA pLKO.1 5732 CDS 100% 4.950 6.930 N RIF1 n/a
4 TRCN0000154859 GCTCTATTGTTAGGTCCCATT pLKO.1 6810 CDS 100% 4.050 5.670 N RIF1 n/a
5 TRCN0000155897 CCACCTGGTTTGCTTAATCAA pLKO.1 4124 CDS 100% 5.625 4.500 N RIF1 n/a
6 TRCN0000220017 TCTTATGAGACGTATAGTATT pLKO.1 8215 3UTR 100% 13.200 9.240 N RIF1 n/a
7 TRCN0000220016 TTTCAACTTCTGGCGGTTAAA pLKO.1 8114 3UTR 100% 13.200 9.240 N RIF1 n/a
8 TRCN0000155431 CGCATTCTGCTGTTGTTGATT pLKO.1 600 CDS 100% 5.625 3.938 N RIF1 n/a
9 TRCN0000155442 GCCTGATGAAGCTGAAACAAA pLKO.1 6292 CDS 100% 5.625 3.938 N RIF1 n/a
10 TRCN0000155531 GCAGCCAAACTGAAACTTGAA pLKO.1 3209 CDS 100% 4.950 3.465 N RIF1 n/a
11 TRCN0000155022 GCTATCTGGAAGGAGCTAATT pLKO.1 1640 CDS 100% 13.200 7.920 N RIF1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 10157 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 10029 3UTR 100% 2.640 1.320 Y LINC01098 n/a
14 TRCN0000357399 GCCAATGGAAACTGGATATAT pLKO_005 14588 3UTR 100% 15.000 7.500 Y SUCNR1 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 10157 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018151.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.