Transcript: Human NM_018338.3

Homo sapiens cilia and flagella associated protein 44 (CFAP44), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
CFAP44 (55779)
Length:
3281
CDS:
68..3016

Additional Resources:

NCBI RefSeq record:
NM_018338.3
NBCI Gene record:
CFAP44 (55779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018338.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427252 AGGGATCACTAGGTCGATTTG pLKO_005 999 CDS 100% 10.800 15.120 N CFAP44 n/a
2 TRCN0000162478 CGAGTCTATGTCCTAAATCAA pLKO.1 2558 CDS 100% 5.625 7.875 N CFAP44 n/a
3 TRCN0000428906 TTCTAGCCACAGGGAGTAAAG pLKO_005 1833 CDS 100% 10.800 8.640 N CFAP44 n/a
4 TRCN0000427832 GTGAAGGAATTGGCGTCATTG pLKO_005 615 CDS 100% 10.800 7.560 N CFAP44 n/a
5 TRCN0000162672 CCTATTGATGTCCGTTATCTT pLKO.1 2450 CDS 100% 5.625 3.938 N CFAP44 n/a
6 TRCN0000159404 GATGCTGATATTCAGTTGAAA pLKO.1 1751 CDS 100% 5.625 3.938 N CFAP44 n/a
7 TRCN0000158587 CCAAACTATCACTTTCAACAT pLKO.1 2494 CDS 100% 4.950 3.465 N CFAP44 n/a
8 TRCN0000162673 CCCAACAAGTAGAAACACTTA pLKO.1 3068 3UTR 100% 4.950 3.465 N CFAP44 n/a
9 TRCN0000160496 CTAATAGCTTTGATGATCGTT pLKO.1 2661 CDS 100% 3.000 2.100 N CFAP44 n/a
10 TRCN0000159573 CCAAAGCATATGCAGTTTAAA pLKO.1 2975 CDS 100% 0.000 0.000 N CFAP44 n/a
11 TRCN0000164930 GCCACATCAAGTTCTGGGAAA pLKO.1 948 CDS 100% 4.050 2.430 N CFAP44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018338.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.