Transcript: Human NM_018400.3

Homo sapiens sodium voltage-gated channel beta subunit 3 (SCN3B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SCN3B (55800)
Length:
6081
CDS:
807..1454

Additional Resources:

NCBI RefSeq record:
NM_018400.3
NBCI Gene record:
SCN3B (55800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018400.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044633 GCGGTAAAGATTTCCTTATTT pLKO.1 1009 CDS 100% 15.000 21.000 N SCN3B n/a
2 TRCN0000438112 ACGTCACTCTGAACGACTCTG pLKO_005 1132 CDS 100% 4.050 5.670 N SCN3B n/a
3 TRCN0000044637 CCTTATTTACGAGTATCGGAA pLKO.1 1022 CDS 100% 2.640 3.696 N SCN3B n/a
4 TRCN0000044634 GCTGCTCATCGAGATGATATA pLKO.1 1322 CDS 100% 13.200 9.240 N SCN3B n/a
5 TRCN0000420997 GGAGTGATTAGTTCGGGTTAA pLKO_005 1888 3UTR 100% 10.800 7.560 N SCN3B n/a
6 TRCN0000044635 CCCATCTGAGAACAAGGAGAA pLKO.1 1409 CDS 100% 4.050 2.835 N SCN3B n/a
7 TRCN0000069248 GCGGTAAAGATTTCCTTATAT pLKO.1 1009 CDS 100% 15.000 21.000 N Scn3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018400.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03656 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03656 pLX_304 0% 100% 100% V5 n/a
Download CSV