Transcript: Human NM_018660.3

Homo sapiens zinc finger protein 395 (ZNF395), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF395 (55893)
Length:
4797
CDS:
127..1668

Additional Resources:

NCBI RefSeq record:
NM_018660.3
NBCI Gene record:
ZNF395 (55893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183104 CGTGTAGATATAACTGGATAT pLKO.1 3750 3UTR 100% 10.800 15.120 N ZNF395 n/a
2 TRCN0000233231 GCATCAAACGACACGTCAAAG pLKO_005 1013 CDS 100% 10.800 15.120 N ZNF395 n/a
3 TRCN0000148383 CCGTGTAGATATAACTGGATA pLKO.1 3749 3UTR 100% 4.950 6.930 N ZNF395 n/a
4 TRCN0000233234 CAGAAGCCTTTACTGATTAAA pLKO_005 2590 3UTR 100% 15.000 10.500 N ZNF395 n/a
5 TRCN0000233230 GCAGCCCAAGGAAGTCCTTAA pLKO_005 294 CDS 100% 10.800 7.560 N ZNF395 n/a
6 TRCN0000233232 TTCCACCACCTCTGCACAAAG pLKO_005 1226 CDS 100% 10.800 7.560 N ZNF395 n/a
7 TRCN0000179444 GAACTCTGTGAAGGTGATGTA pLKO.1 945 CDS 100% 4.950 3.465 N ZNF395 n/a
8 TRCN0000184700 CAGGAACATCGATGTCCCAAA pLKO.1 576 CDS 100% 4.050 2.835 N ZNF395 n/a
9 TRCN0000179338 GCAGAAGGTTTATGTGTGGTA pLKO.1 360 CDS 100% 2.640 1.848 N ZNF395 n/a
10 TRCN0000233233 AGCCAGCACCTGCGATGAAAT pLKO_005 1490 CDS 100% 13.200 7.920 N ZNF395 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.