Transcript: Human NM_018702.4

Homo sapiens adenosine deaminase RNA specific B2 (inactive) (ADARB2), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ADARB2 (105)
Length:
8475
CDS:
376..2595

Additional Resources:

NCBI RefSeq record:
NM_018702.4
NBCI Gene record:
ADARB2 (105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018702.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418083 CACGCGAGTGTGCAATGTTTG pLKO_005 2715 3UTR 100% 10.800 15.120 N ADARB2 n/a
2 TRCN0000418091 CTGAGTCCTGGCATCACAAAC pLKO_005 520 CDS 100% 10.800 15.120 N ADARB2 n/a
3 TRCN0000435720 GTCAACCTTCCTCGCTCCTTT pLKO_005 492 CDS 100% 4.950 6.930 N ADARB2 n/a
4 TRCN0000051894 CGATCGATATTCGTGCGGTTA pLKO.1 1759 CDS 100% 4.050 5.670 N ADARB2 n/a
5 TRCN0000432212 GGCTGAGCAGTCAACTCAAAT pLKO_005 413 CDS 100% 13.200 10.560 N ADARB2 n/a
6 TRCN0000119785 GCAGGAATCGTCATGACCAAA pLKO.1 1546 CDS 100% 4.950 3.960 N Adarb2 n/a
7 TRCN0000051893 CCAAGCGGAAAGATAAAGTAA pLKO.1 464 CDS 100% 5.625 3.938 N ADARB2 n/a
8 TRCN0000051895 CACACCTACCAGTCTGTGAAA pLKO.1 2485 CDS 100% 4.950 3.465 N ADARB2 n/a
9 TRCN0000051897 GCAGTTTCTACTGACTCTCTA pLKO.1 2574 CDS 100% 4.950 3.465 N ADARB2 n/a
10 TRCN0000051896 CGAGAGAACATCCTCTTCCAT pLKO.1 1801 CDS 100% 3.000 2.100 N ADARB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018702.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.