Transcript: Human NM_018713.2

Homo sapiens solute carrier family 30 member 10 (SLC30A10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SLC30A10 (55532)
Length:
2869
CDS:
212..1669

Additional Resources:

NCBI RefSeq record:
NM_018713.2
NBCI Gene record:
SLC30A10 (55532)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421713 TCACATAATCAGACCATATAG pLKO_005 1678 3UTR 100% 13.200 10.560 N SLC30A10 n/a
2 TRCN0000043621 CCCTGCACATCAAGTATCCTA pLKO.1 1254 CDS 100% 3.000 2.400 N SLC30A10 n/a
3 TRCN0000413800 AGTACCACAATAGCTGTATTT pLKO_005 2081 3UTR 100% 13.200 9.240 N SLC30A10 n/a
4 TRCN0000437322 GTCATCTGCCTTCCCGCTTAT pLKO_005 1087 CDS 100% 10.800 7.560 N SLC30A10 n/a
5 TRCN0000043618 CCACGGACAAAGTCTTAACAA pLKO.1 1606 CDS 100% 5.625 3.938 N SLC30A10 n/a
6 TRCN0000043620 GCAAGAGAAGTGGCTATTGAA pLKO.1 1559 CDS 100% 5.625 3.938 N SLC30A10 n/a
7 TRCN0000043622 CTAGACACATACGGAAGTGAT pLKO.1 1520 CDS 100% 4.950 3.465 N SLC30A10 n/a
8 TRCN0000043619 GCCATCATATTCTATGTGCTT pLKO.1 986 CDS 100% 2.640 1.848 N SLC30A10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.