Transcript: Mouse NM_018733.2

Mus musculus sodium channel, voltage-gated, type I, alpha (Scn1a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Scn1a (20265)
Length:
8287
CDS:
188..6184

Additional Resources:

NCBI RefSeq record:
NM_018733.2
NBCI Gene record:
Scn1a (20265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018733.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225831 GCTGGTAGAAACCCTAATTAT pLKO_005 1247 CDS 100% 15.000 21.000 N Scn1a n/a
2 TRCN0000176224 GCAAATTCTACCACTGTGTTA pLKO.1 4266 CDS 100% 4.950 6.930 N Scn1a n/a
3 TRCN0000225834 TGCCAATGCATGTCGATATTA pLKO_005 7334 3UTR 100% 15.000 12.000 N Scn1a n/a
4 TRCN0000175670 GACATATTTGAGATCAGCGAA pLKO.1 4301 CDS 100% 2.640 2.112 N Scn1a n/a
5 TRCN0000219034 ACCACAACTGGTGACATATTT pLKO_005 4289 CDS 100% 15.000 10.500 N Scn1a n/a
6 TRCN0000219581 ACGGATGACCAGAGCGATTAT pLKO.1 4838 CDS 100% 13.200 9.240 N Scn1a n/a
7 TRCN0000225833 ACGGATGACCAGAGCGATTAT pLKO_005 4838 CDS 100% 13.200 9.240 N Scn1a n/a
8 TRCN0000194457 GCTGCAGTTGATTCCAGAAAT pLKO.1 4472 CDS 100% 13.200 9.240 N Scn1a n/a
9 TRCN0000194442 GATCAGCGAAAGACGATCAAA pLKO.1 3881 CDS 100% 5.625 3.938 N Scn1a n/a
10 TRCN0000176347 CTTCCGAATAGTTGAACACAA pLKO.1 3787 CDS 100% 4.950 3.465 N Scn1a n/a
11 TRCN0000194142 GCAAAGAGAAACTCAACGAAA pLKO.1 3576 CDS 100% 4.950 3.465 N Scn1a n/a
12 TRCN0000193511 GTATTTGTACTTCGTCATCTT pLKO.1 4531 CDS 100% 4.950 3.465 N Scn1a n/a
13 TRCN0000173658 CTTTGCTTCAAGTTGCCACAT pLKO.1 4425 CDS 100% 4.050 2.835 N Scn1a n/a
14 TRCN0000225832 TCAGCATCATGGGCGTAAATT pLKO_005 4236 CDS 100% 15.000 9.000 N Scn1a n/a
15 TRCN0000068975 GCTGGGAAGAACCTTCCATTT pLKO.1 356 CDS 100% 10.800 5.400 Y Scn3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018733.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.