Transcript: Mouse NM_018748.3

Mus musculus golgi autoantigen, golgin subfamily a, 4 (Golga4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Golga4 (54214)
Length:
7532
CDS:
169..6885

Additional Resources:

NCBI RefSeq record:
NM_018748.3
NBCI Gene record:
Golga4 (54214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115341 CCTAGTTCTTTATGCTATGAT pLKO.1 7340 3UTR 100% 5.625 7.875 N Golga4 n/a
2 TRCN0000326616 CCTAGTTCTTTATGCTATGAT pLKO_005 7340 3UTR 100% 5.625 7.875 N Golga4 n/a
3 TRCN0000115342 GCAGCAAGAATCCTTGGCTTT pLKO.1 1818 CDS 100% 4.050 5.670 N Golga4 n/a
4 TRCN0000354185 GCAGCAAGAATCCTTGGCTTT pLKO_005 1818 CDS 100% 4.050 5.670 N Golga4 n/a
5 TRCN0000061991 CGTGATGCAAAGAACTTAATT pLKO.1 1273 CDS 100% 15.000 10.500 N GOLGA4 n/a
6 TRCN0000286364 CGTGATGCAAAGAACTTAATT pLKO_005 1273 CDS 100% 15.000 10.500 N GOLGA4 n/a
7 TRCN0000115343 CCCAGCACCAAAGCACTATTA pLKO.1 4574 CDS 100% 13.200 9.240 N Golga4 n/a
8 TRCN0000326615 CCCAGCACCAAAGCACTATTA pLKO_005 4574 CDS 100% 13.200 9.240 N Golga4 n/a
9 TRCN0000306337 GACTTAGAGACTGCGTTAAAG pLKO_005 4756 CDS 100% 13.200 9.240 N Golga4 n/a
10 TRCN0000115345 GCCATCCTTACAGAGAGTGAA pLKO.1 1864 CDS 100% 4.950 3.465 N Golga4 n/a
11 TRCN0000115344 CCATAATTTAGAAGACCGTTT pLKO.1 6597 CDS 100% 4.050 2.835 N Golga4 n/a
12 TRCN0000326551 CCATAATTTAGAAGACCGTTT pLKO_005 6597 CDS 100% 4.050 2.835 N Golga4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018748.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.