Transcript: Mouse NM_018752.3

Mus musculus transient receptor potential cation channel, subfamily M, member 1 (Trpm1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Trpm1 (17364)
Length:
2928
CDS:
439..2067

Additional Resources:

NCBI RefSeq record:
NM_018752.3
NBCI Gene record:
Trpm1 (17364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070006 CCGGACTCTCTACAACAACTT pLKO.1 1887 CDS 100% 4.950 6.930 N Trpm1 n/a
2 TRCN0000070005 GCACACAAATACTGCGACGAA pLKO.1 1102 CDS 100% 2.640 3.696 N Trpm1 n/a
3 TRCN0000070003 CGGAGTGAACATGCAGCATTT pLKO.1 1674 CDS 100% 10.800 8.640 N Trpm1 n/a
4 TRCN0000070004 CCCAAACTGAAGCAGGTGTTT pLKO.1 568 CDS 100% 4.950 3.465 N Trpm1 n/a
5 TRCN0000070007 CCTGTGCAGAATGCAACTCTT pLKO.1 2003 CDS 100% 4.950 3.465 N Trpm1 n/a
6 TRCN0000043974 GCTTCTAGTTACCATTCAGAA pLKO.1 1155 CDS 100% 4.950 3.465 N TRPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.