Transcript: Mouse NM_018771.3

Mus musculus GIPC PDZ domain containing family, member 1 (Gipc1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gipc1 (67903)
Length:
1632
CDS:
95..1096

Additional Resources:

NCBI RefSeq record:
NM_018771.3
NBCI Gene record:
Gipc1 (67903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018771.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037200 CCAGATGAATTTGTCTTTGAT pLKO.1 1034 CDS 100% 5.625 3.938 N Gipc1 n/a
2 TRCN0000037202 GAACCTCGAAAGGCCTTTGAT pLKO.1 731 CDS 100% 5.625 3.938 N Gipc1 n/a
3 TRCN0000308952 GAACCTCGAAAGGCCTTTGAT pLKO_005 731 CDS 100% 5.625 3.938 N Gipc1 n/a
4 TRCN0000037199 CGCCTTCATTAAGCGCATCAA pLKO.1 556 CDS 100% 4.950 3.465 N Gipc1 n/a
5 TRCN0000309025 CGCCTTCATTAAGCGCATCAA pLKO_005 556 CDS 100% 4.950 3.465 N Gipc1 n/a
6 TRCN0000037201 CACTAATGTCAAGGAGCTGTA pLKO.1 322 CDS 100% 4.050 2.835 N Gipc1 n/a
7 TRCN0000309024 CACTAATGTCAAGGAGCTGTA pLKO_005 322 CDS 100% 4.050 2.835 N Gipc1 n/a
8 TRCN0000037203 CTTCGCATTCCCAGATGAATT pLKO.1 1024 CDS 100% 0.000 0.000 N Gipc1 n/a
9 TRCN0000308951 CTTCGCATTCCCAGATGAATT pLKO_005 1024 CDS 100% 0.000 0.000 N Gipc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018771.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.