Transcript: Mouse NM_018807.5

Mus musculus pleiomorphic adenoma gene-like 2 (Plagl2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Plagl2 (54711)
Length:
5407
CDS:
197..1687

Additional Resources:

NCBI RefSeq record:
NM_018807.5
NBCI Gene record:
Plagl2 (54711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018807.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238409 CCTCATACTTGCCCGACAAAC pLKO_005 1236 CDS 100% 10.800 15.120 N Plagl2 n/a
2 TRCN0000362810 CTGCCCATGGGTATGAGTTAC pLKO_005 1151 CDS 100% 10.800 15.120 N Plagl2 n/a
3 TRCN0000220186 GCTTGGATCTACCTCATACTT pLKO.1 1225 CDS 100% 5.625 7.875 N PLAGL2 n/a
4 TRCN0000113955 CGGTTCTATACTCGGAAGGAT pLKO.1 791 CDS 100% 3.000 4.200 N Plagl2 n/a
5 TRCN0000362813 CTGAGTGTGGTAAGAATTATA pLKO_005 585 CDS 100% 15.000 12.000 N Plagl2 n/a
6 TRCN0000362809 TGAGAGTACCCAGGCCCTATT pLKO_005 691 CDS 100% 10.800 8.640 N Plagl2 n/a
7 TRCN0000238411 ATCTGAACTGGGAGCTATATT pLKO_005 1933 3UTR 100% 15.000 10.500 N Plagl2 n/a
8 TRCN0000362811 ATTGTGACAGGCGGTTCTATA pLKO_005 780 CDS 100% 13.200 9.240 N Plagl2 n/a
9 TRCN0000362812 CCTCCAAGTACAAGCTGTATA pLKO_005 435 CDS 100% 13.200 9.240 N Plagl2 n/a
10 TRCN0000113951 GCTGGTTATCTGCCTTCAATT pLKO.1 4129 3UTR 100% 13.200 9.240 N Plagl2 n/a
11 TRCN0000238412 TAGCTCTACAGTCAGTGTAAA pLKO_005 982 CDS 100% 13.200 9.240 N Plagl2 n/a
12 TRCN0000238410 TCCGGAGCAGAGACCATATAG pLKO_005 382 CDS 100% 13.200 9.240 N Plagl2 n/a
13 TRCN0000238413 TGTTGCCCATGGGTATGTATG pLKO_005 1071 CDS 100% 10.800 7.560 N Plagl2 n/a
14 TRCN0000113952 GCCTCCAAGTACAAGCTGTAT pLKO.1 434 CDS 100% 4.950 3.465 N Plagl2 n/a
15 TRCN0000113954 GCCAGTGGATATGTTAGGCTT pLKO.1 952 CDS 100% 2.640 1.848 N Plagl2 n/a
16 TRCN0000113953 GCTCTGAGTGTGGTAAGAATT pLKO.1 582 CDS 100% 0.000 0.000 N Plagl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018807.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.