Transcript: Mouse NM_018811.6

Mus musculus abhydrolase domain containing 2 (Abhd2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Abhd2 (54608)
Length:
2903
CDS:
181..1458

Additional Resources:

NCBI RefSeq record:
NM_018811.6
NBCI Gene record:
Abhd2 (54608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018811.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121482 GCCTGTGAAACAAAGGAAATT pLKO.1 1952 3UTR 100% 13.200 9.240 N Abhd2 n/a
2 TRCN0000121486 GCCGCTGACATGGATGGATAA pLKO.1 1344 CDS 100% 10.800 7.560 N Abhd2 n/a
3 TRCN0000121485 CCTGAAGGAATACTATGAGGA pLKO.1 1128 CDS 100% 2.640 1.848 N Abhd2 n/a
4 TRCN0000121484 GCTATAATTCCCTGAAGGAAT pLKO.1 1118 CDS 100% 0.495 0.347 N Abhd2 n/a
5 TRCN0000121483 CCACAGCGAGAAGCAGTATAT pLKO.1 588 CDS 100% 13.200 7.920 N Abhd2 n/a
6 TRCN0000377335 TCAGCCTGGGTGGTAACATTG pLKO_005 797 CDS 100% 10.800 7.560 N ABHD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018811.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07738 pDONR223 100% 91.5% 98.5% None (many diffs) n/a
2 ccsbBroad304_07738 pLX_304 0% 91.5% 98.5% V5 (many diffs) n/a
Download CSV