Transcript: Mouse NM_018825.4

Mus musculus SH2B adaptor protein 2 (Sh2b2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sh2b2 (23921)
Length:
2904
CDS:
339..2204

Additional Resources:

NCBI RefSeq record:
NM_018825.4
NBCI Gene record:
Sh2b2 (23921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018825.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100118 GATCGGCTGATATCACCCTAA pLKO.1 1828 CDS 100% 4.050 5.670 N Sh2b2 n/a
2 TRCN0000100115 CCACTCCCATTAGCAGCTATT pLKO.1 2496 3UTR 100% 10.800 7.560 N Sh2b2 n/a
3 TRCN0000100116 CGGCTGATATCACCCTAAGAA pLKO.1 1831 CDS 100% 5.625 3.938 N Sh2b2 n/a
4 TRCN0000100117 GAGCAGAATACATCCTGGAAA pLKO.1 1159 CDS 100% 4.950 3.465 N Sh2b2 n/a
5 TRCN0000100119 GTGGAGAATCAGTACTCCTTT pLKO.1 2178 CDS 100% 4.950 3.465 N Sh2b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018825.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.