Transcript: Mouse NM_018860.4

Mus musculus ribosomal protein L41 (Rpl41), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rpl41 (67945)
Length:
459
CDS:
95..172

Additional Resources:

NCBI RefSeq record:
NM_018860.4
NBCI Gene record:
Rpl41 (67945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353213 AGAAGAGAATGCGCAGGCTGA pLKO_005 114 CDS 100% 2.160 1.296 N Rpl41 n/a
2 TRCN0000329146 TGAGGCAGAGGTCCAAGTAAG pLKO_005 153 CDS 100% 10.800 5.400 Y Rpl41 n/a
3 TRCN0000345612 ATGAGGCAGAGGTCCAAGTAA pLKO_005 152 CDS 100% 5.625 2.813 Y Rpl41 n/a
4 TRCN0000179263 GAAGCGCAAGAGAAGAAAGAT pLKO.1 133 CDS 100% 5.625 2.813 Y Rpl41 n/a
5 TRCN0000179895 CATCGGTAATGAGTCTCAGTA pLKO.1 256 3UTR 100% 4.950 2.475 Y Rpl41 n/a
6 TRCN0000329144 ACTGTGTGCTGCCATCGGTAA pLKO_005 244 3UTR 100% 4.050 2.025 Y Rpl41 n/a
7 TRCN0000329216 GACAAGCTATCGGACTGTGTG pLKO_005 231 3UTR 100% 4.050 2.025 Y Rpl41 n/a
8 TRCN0000329145 GAGTCTCAGTAGACCTGGAAC pLKO_005 266 3UTR 100% 4.050 2.025 Y Rpl41 n/a
9 TRCN0000184801 CCATCGGTAATGAGTCTCAGT pLKO.1 255 3UTR 100% 2.640 1.320 Y Rpl41 n/a
10 TRCN0000329142 CCATCGGTAATGAGTCTCAGT pLKO_005 255 3UTR 100% 2.640 1.320 Y Rpl41 n/a
11 TRCN0000196000 CGCAAGAGAAGAAAGATGAGG pLKO.1 137 CDS 100% 2.640 1.320 Y Rpl41 n/a
12 TRCN0000180882 GAAGAAAGATGAGGCAGAGGT pLKO.1 144 CDS 100% 2.640 1.320 Y RPL41 n/a
13 TRCN0000345610 TCAGTAGACCTGGAACGTCAC pLKO_005 271 3UTR 100% 2.250 1.125 Y Rpl41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018860.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.