Transcript: Human NM_018942.3

Homo sapiens H6 family homeobox 1 (HMX1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
HMX1 (3166)
Length:
1917
CDS:
226..1272

Additional Resources:

NCBI RefSeq record:
NM_018942.3
NBCI Gene record:
HMX1 (3166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431049 ACTACGAACCGGCTGTCCAAG pLKO_005 1636 3UTR 100% 1.350 1.890 N HMX1 n/a
2 TRCN0000431683 GAGCGCCTCTAGAATGTAATG pLKO_005 1442 3UTR 100% 10.800 7.560 N HMX1 n/a
3 TRCN0000014848 CCCAACACTAAACGTCCCTTT pLKO.1 1687 3UTR 100% 4.050 2.835 N HMX1 n/a
4 TRCN0000014850 CTCCTCCTTCCTCATCGAGAA pLKO.1 273 CDS 100% 4.050 2.835 N HMX1 n/a
5 TRCN0000070722 CCTCCTCCTTCCTCATCGAGA pLKO.1 272 CDS 100% 0.880 0.616 N Hmx1 n/a
6 TRCN0000014849 GCTGGAATCCACCTTCGACCT pLKO.1 876 CDS 100% 0.720 0.504 N HMX1 n/a
7 TRCN0000014852 CACGACCCTGTGGACCTGTGT pLKO.1 1297 3UTR 100% 0.000 0.000 N HMX1 n/a
8 TRCN0000014851 GTGCCGGTGCTCTACCACGAA pLKO.1 1069 CDS 100% 0.000 0.000 N HMX1 n/a
9 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 971 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.