Transcript: Human NM_019063.5

Homo sapiens EMAP like 4 (EML4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
EML4 (27436)
Length:
5546
CDS:
260..3205

Additional Resources:

NCBI RefSeq record:
NM_019063.5
NBCI Gene record:
EML4 (27436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019063.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303638 TCAGATGATAGCCGTAATAAA pLKO_005 821 CDS 100% 15.000 21.000 N EML4 n/a
2 TRCN0000117340 CGGCAATTCACTAACAAGAAA pLKO.1 1576 CDS 100% 5.625 7.875 N EML4 n/a
3 TRCN0000117339 CGGCCAATTACCATGTTCATT pLKO.1 959 CDS 100% 5.625 7.875 N EML4 n/a
4 TRCN0000117338 GCGGCAATTCACTAACAAGAA pLKO.1 1575 CDS 100% 4.950 6.930 N EML4 n/a
5 TRCN0000299398 GCGGCAATTCACTAACAAGAA pLKO_005 1575 CDS 100% 4.950 6.930 N EML4 n/a
6 TRCN0000117337 CGCCAGTAAGTATCAGGCATA pLKO.1 5028 3UTR 100% 4.050 3.240 N EML4 n/a
7 TRCN0000299477 CGCCAGTAAGTATCAGGCATA pLKO_005 5028 3UTR 100% 4.050 3.240 N EML4 n/a
8 TRCN0000303639 CATCAGTAGTAGTACTATTTA pLKO_005 1125 CDS 100% 15.000 10.500 N EML4 n/a
9 TRCN0000117341 CGGATTGTAAGGACATTGATT pLKO.1 2541 CDS 100% 5.625 3.938 N EML4 n/a
10 TRCN0000299397 CGGATTGTAAGGACATTGATT pLKO_005 2541 CDS 100% 5.625 3.938 N EML4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019063.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.