Transcript: Mouse NM_019444.2

Mus musculus receptor (calcitonin) activity modifying protein 2 (Ramp2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ramp2 (54409)
Length:
872
CDS:
119..688

Additional Resources:

NCBI RefSeq record:
NM_019444.2
NBCI Gene record:
Ramp2 (54409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042773 CGACACAATGTTTGTAGTCTT pLKO.1 826 3UTR 100% 4.950 6.930 N Ramp2 n/a
2 TRCN0000042775 CCTGCAGAACTGCTTGGAATA pLKO.1 445 CDS 100% 10.800 7.560 N Ramp2 n/a
3 TRCN0000042774 CCTACCTTGCTGGTATGAGTA pLKO.1 358 CDS 100% 4.950 3.465 N Ramp2 n/a
4 TRCN0000042776 GAGTCCCTGAACCAATCTCTT pLKO.1 257 CDS 100% 4.950 3.465 N Ramp2 n/a
5 TRCN0000042777 GACTTTGATTAGCAGGCATTA pLKO.1 418 CDS 100% 10.800 6.480 N Ramp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.