Transcript: Mouse NM_019455.4

Mus musculus hematopoietic prostaglandin D synthase (Hpgds), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hpgds (54486)
Length:
3298
CDS:
68..667

Additional Resources:

NCBI RefSeq record:
NM_019455.4
NBCI Gene record:
Hpgds (54486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019455.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076048 GCAGGGAAATAGTTCACAATA pLKO.1 865 3UTR 100% 13.200 18.480 N Hpgds n/a
2 TRCN0000302727 GCAGGGAAATAGTTCACAATA pLKO_005 865 3UTR 100% 13.200 18.480 N Hpgds n/a
3 TRCN0000076049 GCCGAAATTATTCGCTACATA pLKO.1 110 CDS 100% 5.625 7.875 N Hpgds n/a
4 TRCN0000076052 GCCTGGCTTGTTGGATATCTA pLKO.1 559 CDS 100% 5.625 4.500 N Hpgds n/a
5 TRCN0000302801 GCCTGGCTTGTTGGATATCTA pLKO_005 559 CDS 100% 5.625 4.500 N Hpgds n/a
6 TRCN0000076051 AGCCGAAATTATTCGCTACAT pLKO.1 109 CDS 100% 4.950 3.960 N Hpgds n/a
7 TRCN0000302799 AGCCGAAATTATTCGCTACAT pLKO_005 109 CDS 100% 4.950 3.960 N Hpgds n/a
8 TRCN0000076050 GCCTCGCAATAGCAAGATATT pLKO.1 258 CDS 100% 13.200 9.240 N Hpgds n/a
9 TRCN0000302800 GCCTCGCAATAGCAAGATATT pLKO_005 258 CDS 100% 13.200 9.240 N Hpgds n/a
10 TRCN0000192383 CCAGAGGTTCTGAGTTCAATT pLKO.1 1423 3UTR 100% 13.200 6.600 Y Lrrc29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019455.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.