Transcript: Mouse NM_019465.4

Mus musculus cytotoxic and regulatory T cell molecule (Crtam), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Crtam (54698)
Length:
1936
CDS:
43..1221

Additional Resources:

NCBI RefSeq record:
NM_019465.4
NBCI Gene record:
Crtam (54698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419030 GAACTACATCACGCGGTTATA pLKO_005 1119 CDS 100% 13.200 18.480 N Crtam n/a
2 TRCN0000173122 CGTGTGTTACTTCTCAGACAA pLKO.1 146 CDS 100% 4.950 6.930 N Crtam n/a
3 TRCN0000445987 CTCAACCGTGCACTGCATTAT pLKO_005 609 CDS 100% 13.200 9.240 N Crtam n/a
4 TRCN0000193075 CTCTAGAAAGTTACAGATCAA pLKO.1 1031 CDS 100% 4.950 3.465 N Crtam n/a
5 TRCN0000173251 CTTCACCATTCAGCTACACAA pLKO.1 256 CDS 100% 4.950 3.465 N Crtam n/a
6 TRCN0000175878 GAAATTTCAGAGCAAGCTCTA pLKO.1 1015 CDS 100% 4.050 2.835 N Crtam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.