Transcript: Mouse NM_019548.4

Mus musculus trophinin (Tro), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-22
Taxon:
Mus musculus (mouse)
Gene:
Tro (56191)
Length:
3859
CDS:
118..3036

Additional Resources:

NCBI RefSeq record:
NM_019548.4
NBCI Gene record:
Tro (56191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019548.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094061 CGAAAGTCTAAGCATCCCAAT pLKO.1 1783 CDS 100% 4.050 5.670 N Tro n/a
2 TRCN0000094059 CCCTGTTTACAGATAACGCTA pLKO.1 3057 3UTR 100% 2.640 3.696 N Tro n/a
3 TRCN0000094060 CGGCAAACAATGCTGCCAATA pLKO.1 659 CDS 100% 10.800 8.640 N Tro n/a
4 TRCN0000438508 GAGTCATCTGCAGGCATAATG pLKO_005 2104 CDS 100% 13.200 9.240 N Tro n/a
5 TRCN0000419571 CCAGTTACCACACCGACTATC pLKO_005 565 CDS 100% 10.800 7.560 N Tro n/a
6 TRCN0000094062 GCAGACAGATTGAGGCATCTA pLKO.1 1166 CDS 100% 4.950 3.465 N Tro n/a
7 TRCN0000094063 GCAGGCTTTAAACCTACCAAT pLKO.1 372 CDS 100% 4.950 3.465 N Tro n/a
8 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 3733 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019548.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.