Transcript: Mouse NM_019575.4

Mus musculus secretory carrier membrane protein 4 (Scamp4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Scamp4 (56214)
Length:
1802
CDS:
110..802

Additional Resources:

NCBI RefSeq record:
NM_019575.4
NBCI Gene record:
Scamp4 (56214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019575.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105626 CCAGGACTTCTCTGATGAGAT pLKO.1 175 CDS 100% 4.950 3.465 N Scamp4 n/a
2 TRCN0000324180 CCAGGACTTCTCTGATGAGAT pLKO_005 175 CDS 100% 4.950 3.465 N Scamp4 n/a
3 TRCN0000105628 CCGAGCCGACAGCTCCTTTAA pLKO.1 400 CDS 100% 4.400 3.080 N Scamp4 n/a
4 TRCN0000324178 CCGAGCCGACAGCTCCTTTAA pLKO_005 400 CDS 100% 4.400 3.080 N Scamp4 n/a
5 TRCN0000105625 GCTGAGATGTATAAAGCCAAA pLKO.1 1070 3UTR 100% 4.050 2.835 N Scamp4 n/a
6 TRCN0000324179 GCTGAGATGTATAAAGCCAAA pLKO_005 1070 3UTR 100% 4.050 2.835 N Scamp4 n/a
7 TRCN0000105627 GCCCAGTTTAACAGTTTCTCT pLKO.1 716 CDS 100% 3.000 2.100 N Scamp4 n/a
8 TRCN0000324177 GCCCAGTTTAACAGTTTCTCT pLKO_005 716 CDS 100% 3.000 2.100 N Scamp4 n/a
9 TRCN0000105629 CCCTTGTGATGGCCGTCACTA pLKO.1 594 CDS 100% 1.650 1.155 N Scamp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019575.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.