Transcript: Mouse NM_019680.2

Mus musculus E74-like factor 4 (ets domain transcription factor) (Elf4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Elf4 (56501)
Length:
5847
CDS:
266..2233

Additional Resources:

NCBI RefSeq record:
NM_019680.2
NBCI Gene record:
Elf4 (56501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360668 GGGCGAGCCCTGAGATATTAT pLKO_005 1058 CDS 100% 15.000 21.000 N Elf4 n/a
2 TRCN0000054708 GCCCTGAGATATTATTATCAA pLKO.1 1064 CDS 100% 5.625 7.875 N Elf4 n/a
3 TRCN0000054712 GCATGCCTATACGGAAGAAAT pLKO.1 843 CDS 100% 13.200 10.560 N Elf4 n/a
4 TRCN0000054710 GCTCCAACTCAACTCGTTCTT pLKO.1 1574 CDS 100% 4.950 3.960 N Elf4 n/a
5 TRCN0000054711 CCCTATCCTGAATTAGTGCAT pLKO.1 383 CDS 100% 2.640 2.112 N Elf4 n/a
6 TRCN0000360598 GGTCCACAATGGCATCATAAG pLKO_005 430 CDS 100% 10.800 7.560 N Elf4 n/a
7 TRCN0000054709 CCACCTCAAATAACGTGTCAT pLKO.1 522 CDS 100% 4.950 3.465 N Elf4 n/a
8 TRCN0000360596 GTCATCCACTGAAGTCCTATT pLKO_005 538 CDS 100% 10.800 6.480 N Elf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.