Transcript: Mouse NM_019754.3

Mus musculus transgelin 3 (Tagln3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tagln3 (56370)
Length:
1269
CDS:
226..825

Additional Resources:

NCBI RefSeq record:
NM_019754.3
NBCI Gene record:
Tagln3 (56370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108785 CCCGTGACAAAGAAATAGGTA pLKO.1 880 3UTR 100% 3.000 2.400 N Tagln3 n/a
2 TRCN0000108786 GCAAGCTGATAAACAGTTTAT pLKO.1 413 CDS 100% 13.200 9.240 N Tagln3 n/a
3 TRCN0000444882 TCCTTGCAAGTGCTGCATTTC pLKO_005 947 3UTR 100% 10.800 7.560 N Tagln3 n/a
4 TRCN0000445559 GATGCCCAGGCAGATCATGTA pLKO_005 804 CDS 100% 4.950 3.465 N TAGLN3 n/a
5 TRCN0000146486 CTCAGAGTCAAAGATGGCTTT pLKO.1 465 CDS 100% 4.050 2.835 N TAGLN3 n/a
6 TRCN0000108787 CCATCCTGGTTTCACAGGAAA pLKO.1 667 CDS 100% 0.495 0.347 N Tagln3 n/a
7 TRCN0000108789 CCCAGCAGAATCGGAGAGGAT pLKO.1 689 CDS 100% 0.880 0.528 N Tagln3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.