Transcript: Mouse NM_019759.2

Mus musculus dermatopontin (Dpt), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dpt (56429)
Length:
1636
CDS:
1..606

Additional Resources:

NCBI RefSeq record:
NM_019759.2
NBCI Gene record:
Dpt (56429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119304 GCGAGGAGCAACAACCACTTT pLKO.1 504 CDS 100% 4.950 6.930 N Dpt n/a
2 TRCN0000351956 GCGAGGAGCAACAACCACTTT pLKO_005 504 CDS 100% 4.950 6.930 N Dpt n/a
3 TRCN0000119302 CGTCCTCTATTCAAAGATATA pLKO.1 1246 3UTR 100% 13.200 9.240 N Dpt n/a
4 TRCN0000119306 CTGGATCGTGAGTGGCAATTT pLKO.1 370 CDS 100% 13.200 9.240 N Dpt n/a
5 TRCN0000375417 CTTGAGAGAGGTGGGATAAAG pLKO_005 993 3UTR 100% 13.200 9.240 N Dpt n/a
6 TRCN0000375418 TGAGGGTGTCATATCACATAT pLKO_005 655 3UTR 100% 13.200 9.240 N Dpt n/a
7 TRCN0000119305 CTATAGCAAGAGGTGTCCATA pLKO.1 402 CDS 100% 4.950 3.465 N Dpt n/a
8 TRCN0000367665 CTATAGCAAGAGGTGTCCATA pLKO_005 402 CDS 100% 4.950 3.465 N Dpt n/a
9 TRCN0000119303 GAGGAGCATCTTTAGCAAGAA pLKO.1 177 CDS 100% 4.950 3.465 N Dpt n/a
10 TRCN0000351955 GAGGAGCATCTTTAGCAAGAA pLKO_005 177 CDS 100% 4.950 3.465 N Dpt n/a
11 TRCN0000155090 GATCGCCAGTGGAAGTTCATA pLKO.1 541 CDS 100% 5.625 3.938 N DPT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.