Transcript: Mouse NM_019769.3

Mus musculus calcineurin-like EF hand protein 1 (Chp1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Chp1 (56398)
Length:
2626
CDS:
145..732

Additional Resources:

NCBI RefSeq record:
NM_019769.3
NBCI Gene record:
Chp1 (56398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264519 ACCAACTGAGGTGACATTTAG pLKO_005 2026 3UTR 100% 13.200 18.480 N Chp1 n/a
2 TRCN0000264516 GAATGATGGTTGGAGTGAATA pLKO_005 563 CDS 100% 13.200 18.480 N Chp1 n/a
3 TRCN0000236438 GACTCTCAGCCGGGAAGATTT pLKO_005 276 CDS 100% 13.200 18.480 N CHP1 n/a
4 TRCN0000236441 GCATCCGATTTCTTCACTAAA pLKO_005 713 CDS 100% 13.200 18.480 N CHP1 n/a
5 TRCN0000264520 GACTCTATGATTTGGATAAAG pLKO_005 503 CDS 100% 13.200 9.240 N Chp1 n/a
6 TRCN0000264517 AGAGGGAGAGGATCAGGTAAA pLKO_005 360 CDS 100% 10.800 7.560 N Chp1 n/a
7 TRCN0000264518 TTCCGACCCATTGAGGATAAC pLKO_005 412 CDS 100% 10.800 7.560 N Chp1 n/a
8 TRCN0000180134 CCTGACTTATCTCAGTCCTAA pLKO.1 1788 3UTR 100% 4.950 3.465 N Chp1 n/a
9 TRCN0000184031 CGGGAAGATTTCCAGAGGATT pLKO.1 286 CDS 100% 4.950 3.465 N Chp1 n/a
10 TRCN0000180593 GCACTTTGCTTTCAGACTCTA pLKO.1 489 CDS 100% 4.950 3.465 N Chp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.