Transcript: Mouse NM_019776.2

Mus musculus staphylococcal nuclease and tudor domain containing 1 (Snd1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Snd1 (56463)
Length:
3482
CDS:
218..2950

Additional Resources:

NCBI RefSeq record:
NM_019776.2
NBCI Gene record:
Snd1 (56463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295696 TCTCGCCTCAAGCTCTATTTA pLKO_005 1829 CDS 100% 15.000 10.500 N Snd1 n/a
2 TRCN0000295695 TGCCTTCAGCACGCGTGTATT pLKO_005 2563 CDS 100% 13.200 9.240 N Snd1 n/a
3 TRCN0000295753 GACCTGGTTGAGGGAGTATAG pLKO_005 3025 3UTR 100% 10.800 7.560 N Snd1 n/a
4 TRCN0000054738 CCACTGCTAATTTGGACCAAA pLKO.1 1212 CDS 100% 4.950 3.465 N Snd1 n/a
5 TRCN0000054739 CGCAAGAAGCTGATTGGGAAA pLKO.1 476 CDS 100% 4.050 2.835 N Snd1 n/a
6 TRCN0000054742 GCATGTCTTCTACATCGACTA pLKO.1 2494 CDS 100% 4.050 2.835 N Snd1 n/a
7 TRCN0000288368 GCATGTCTTCTACATCGACTA pLKO_005 2494 CDS 100% 4.050 2.835 N Snd1 n/a
8 TRCN0000054740 GCCAAATTTGTAGATGGAGAA pLKO.1 2429 CDS 100% 4.050 2.835 N Snd1 n/a
9 TRCN0000054741 CCTCAAGTACACCATTGAGAA pLKO.1 742 CDS 100% 0.495 0.347 N Snd1 n/a
10 TRCN0000288426 CCTCAAGTACACCATTGAGAA pLKO_005 742 CDS 100% 0.495 0.347 N Snd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019776.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.