Transcript: Mouse NM_019810.4

Mus musculus solute carrier family 5 (sodium/glucose cotransporter), member 1 (Slc5a1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Slc5a1 (20537)
Length:
3933
CDS:
239..2236

Additional Resources:

NCBI RefSeq record:
NM_019810.4
NBCI Gene record:
Slc5a1 (20537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019810.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079914 GCTGGATATTTGTCCCGATTT pLKO.1 576 CDS 100% 10.800 15.120 N Slc5a1 n/a
2 TRCN0000079915 GCCGGATTCTATATACAGAAA pLKO.1 1242 CDS 100% 4.950 6.930 N Slc5a1 n/a
3 TRCN0000079916 GTGGTGAACATCAACGGTATT pLKO.1 2171 CDS 100% 10.800 7.560 N Slc5a1 n/a
4 TRCN0000079917 CATGAAAGCTATTCCAACTAA pLKO.1 946 CDS 100% 5.625 3.938 N Slc5a1 n/a
5 TRCN0000079913 GCCACAATGATTGGCTTGTAA pLKO.1 3294 3UTR 100% 5.625 3.938 N Slc5a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019810.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.